SubtiBank SubtiBank
ptsH [2018-02-13T11:48:25.000Z]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

ptsH [2018-02-13T11:48:25.000Z]

HPr, General component of the sugar phosphotransferase system (PTS)
Locus
BSU13900
Isoelectric point
4.58
Molecular weight
9.05 kDa
Protein length
Gene length
264 bp Sequence Blast
Function
PTS-dependent sugar transport and carbon catabolite repression
Product
histidine-containing phosphocarrier protein HPr of the PTS
Essential
no
E.C.
2.7.11.-
Synonyms
HPr

Genomic Context

      
Loading

Categories containing this gene/protein

Gene

Coordinates
1,459,384 → 1,459,650

The protein

Catalyzed reaction/ biological activity

  • Protein HPr N(pi)-phospho-L-histidine + protein EIIA = protein HPr + protein EIIA N(tau)-phospho-L-histidine (according to Swiss-Prot)
  • Protein family

  • HPr domain (according to Swiss-Prot) HPr family
  • Paralogous protein(s)

    Domains

  • HPr Domain (2–88)
  • Modification

  • transient phosphorylation by Enzyme I of the PTS on His-15
  • regulatory phosphorylation on Ser-46 by HprK PubMed
  • an extensive study on in vivo HPr phosphorylation can be found in Singh et al. (2008) PubMed
  • weak phosphorylation on Ser-12 PubMed
  • in vitro phosphorylated by PrkC on Ser-12 PubMed
  • Structure

  • 2HID (NMR) PubMed
  • 1KKM (complex of L. casei HprK with B. subtilis HPr-Ser-P)
  • 1KKL (complex of Lactobacillus casei HprK with B. subtilis HPr)
  • 3OQM (complex of B. subtilis CcpA with P-Ser-HPr and the ackA operator site)
  • 3OQN (complex of B. subtilis CcpA with P-Ser-HPr and the gntR operator site)
  • 3OQO (complex of B. subtilis CcpA with P-Ser-HPr and a optimal synthetic operator site)
  • Localization

  • cytoplasm PubMed
  • Additional information

  • belongs to the 100 most abundant proteins PubMed
  • Expression and Regulation

    Operons

    Genes
    Description

    Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • view in new tab

    Description

    Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • Regulatory mechanism

  • stringent response: negative regulation, in stringent response
  • GlcT: antitermination, via the GlcT-dependent RNA switch PubMed, in GlcT regulon
  • Regulation

  • expression activated by glucose (2 fold) (GlcT) PubMed
  • view in new tab

    Biological materials

    Mutant

  • available in Jörg Stülke's lab:
  • MZ303 (cat)
  • GP507 ptsH1 (S46A)
  • GP506 (ptsH-H15A)
  • GP778 (ΔglcT-ptsG-ptsH-ptsI::spc) PubMed
  • BKE13900 (ΔptsH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • BKK13900 (ΔptsH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • Expression vector

  • pGP438 (with N-terminal Strep-tag, in pGP172), available in Jörg Stülke's lab
  • pAG2 (His-tag) PubMed, available in Anne Galinier lab
  • pGP371(expression / purification of HPr-S46A, with His-tag from E. coli, in pWH844), available in Jörg Stülke's lab
  • pGP1415 (HPr, expression in B. subtilis, from pBQ200), available in Jörg Stülke's lab
  • pGP961 (HPr, expression in B. subtilis with N-terminal Strep-tag, for SPINE, available in Jörg Stülke's lab
  • pGP1416 (HPr-H15A, expression in B. subtilis, from pBQ200), available in Jörg Stülke's lab
  • pGP2431 (N-terminal Strep-tag, expression and purification from B. subtilis, in pGP380), for SPINE, available in Jörg Stülke's lab
  • Two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab
  • Antibody

  • available in Jörg Stülke's lab
  • Labs working on this gene/protein

  • Josef Deutscher, Paris-Grignon, France
  • Jörg Stülke, University of Göttingen, Germany Homepage
  • Richard Brennan, Houston, Texas, USA Homepage
  • Boris Görke, University of Göttingen, Germany Homepage
  • Anne Galinier, University of Marseille, France
  • References

    Loading